Dotter User Manual

User Manual:

Open the PDF directly: View PDF .
Page Count: 17

Download
Open PDF In Browser	View PDF

Dotter User Manual
Written by Gemma Barson


Wellcome Trust Sanger Institute
18 January 2011

Revision History
Revision

Date

Author

First revision (Dotter v4.1.5)

18/01/11

Gemma Barson

Updated for Dotter v4.1.9

10/02/11

Gemma Barson

Updated for Dotter v4.1.13

25/03/11

Gemma Barson

Updated for Dotter v4.1.14

04/04/11

Gemma Barson

Updated for Dotter v4.7

02/12/11

Gemma Barson

Updated for Dotter v4.27

17/04/14

Gemma Barson

2

Contents
Revision History

2

Introduction

4

Getting Started
Running Dotter . . . . . . .
Sequence versus itself .
Input files . . . . . . . . . .
FASTA file . . . . . .
GFF file . . . . . . . .
Transcripts . . . . . .
Sample GFF file . . .

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

4
4
4
4
6
6
7
7

The Dotter Windows
The dot-plot window . . . . . . .
Cross-hair . . . . . . . . . .
Zoom in with a child Dotter
The alignment tool . . . . . . . .
Alignment tool menu . . .
Alignment tool shortcuts . .
Greyramp tool . . . . . . . . . .

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

7
7
7
9
9
10
11
11

Main menu
File menu .
Edit menu .
View menu
Help menu .

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

11
11
13
14
15

Settings
Zoom . . . . . . . . . . . . . .
Horizontal range . . . . . . . .
Vertical range . . . . . . . . . .
Sliding window size . . . . . . .
Show break-lines . . . . . . . .
Show break-lines . . . . . . . .
Show horizontal sequence labels
Show vertical sequence labels .

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

15
15
15
15
16
16
16
16
16

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

Keyboard shortcuts

3

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.
.
.
.

.
.
.
.

.
.
.
.
.
.
.

.
.
.
.

.
.
.
.

17

Introduction
This manual explains how to configure, run and use Dotter. Dotter is a graphical dot-plot program
for detailed comparison of two sequences. Every residue in one sequence is compared to every residue
in the other sequence. The first sequence runs along the x-axis and the second sequence along the
y-axis. In regions where the two sequences are similar to each other, a row of high scores will run
diagonally across the dot matrix.
Pairwise scores are averaged over a sliding window to make the score matrix more intelligible. The
averaged score matrix forms a three-dimensional landscape, with the two sequences in two dimensions
and the height of the peaks in the third. This landscape is projected onto two dimensions using a
grey-scale image - the darker grey of a peak, the higher the score is.
The contrast and threshold of the grey-scale image can be adjusted, and a tool is provided to examine
the sequence alignment that the grey-scale image represents.
Dotter is maintained by the Wellcome Trust Sanger Institute and is available as part of the SeqTools
package. The software can be downloaded from the Sanger Institute’s website:
http://www.sanger.ac.uk/resources/software/seqtools

Getting Started
Running Dotter
As a minimum, Dotter takes the following required arguments:
dotter  
where  and  are the path names of FASTA files containing the two input sequences. Dotter will assume that the sequences both start at coordinate
1 unless you use the -q and -s arguments to set an offset for the query (horizontal) and subject
(vertical) sequences respectively.
Run ‘dotter‘ without any arguments to see further usage information.
Sequence versus itself
Dotter can be run on a sequence versus itself. This can be useful to analyse internal repeats. You
can also look for overlaps between many sequences by making a dot-plot of all of the sequences
versus themselves. To run Dotter on many sequences at once, concatenate the FASTA files for all
of the sequences and then run Dotter on the concatenated sequence file against itself.
If you're comparing a sequence against itself, you'll notice that the main diagonal scores maximally,
since it's the 100% perfect self-match. Partitioning break-lines will appear between the sequences
if there were multiple sequences in the input file.

Input files
The sequence input files are in FASTA format. Comparisons are allowed between two nucleotide
sequences, two protein sequences, or one nucleotide and one protein sequence – note that when

4

Figure 1: Multiple sequences vs themselves

5

comparing a nucleotide and a protein sequence, the nucleotide sequence must be passed first (i.e. as
the horizontal sequence).
Additional features can be passed to Dotter in a GFF file using the -f argument. Relevant features
include alignments, which can be viewed using Dotter's HSP mode, and transcripts, which are shown
at the bottom of the Dotter window.
FASTA file
A FASTA file has a header line that starts with ‘>’ and contains the sequence name. The next line
contains the start of the sequence data. The sequence data can be on a single line or separated by
newlines; it is usually separated by newlines every 50 characters to aid readability.
>chr4-04
tcttgtttctgtaggagaggccatctccatcagctataaccaaaaaaaaa
acaaaaaactcctctttttgacaagtttgtaaagcctgtccatctgggtc
tataataatcctccaggccctatgccactcctctttattcagccagttca
...

GFF file
Dotter uses the GFF version 3 file format. In this section we give a very brief description of this
file format; see http://www.sequenceontology.org/gff3.shtml for a full description.
The GFF file should start with the following two comment lines.
included but may be ignored.)

(Additional comments can be

##gff-version 3
##sequence-region chr4-04 44144 154265
Each subsequent line defines a feature.
columns:

A feature line must have the following 8 tab-separated

reference_sequence_name source type start end score strand phase
An optional 9th column defines any tags (separated by semi-colons). Dotter supports the following
GFF tags. (Additional tags can be supplied but may be ignored.)

6

Target

(required for alignments)

Gap

(required for gapped alignments)

ID

(required for parent features)

Name

(required for transcripts and SNPs)

Parent

(required for child features)

Transcripts
Note that exons should have a Parent transcript defined, and the Name tag should be set in the
parent rather than the child exons. Note that Dotter will recognise exons that do not have a Parent
tag if they have a Name tag instead, but they may not get grouped correctly with other exons from
the same transcript.
Typically, one defines the parent transcript, the exons, and the CDS regions; Dotter will then
calculate the missing components (in this case, the UTR regions and the introns). Dotter will
recognise other combinations of inputs, and will always calculate the missing components as long as
enough information is provided.
Sample GFF file
A sample GFF file may look like this (‘. . . ‘ denotes that text has been omitted).
##gff-version 3
##sequence-region chr4-04 44144 154265
chr4-04 EST_Human nucleotide_match 79195 79311 95.000000 - . Target=DA692754.1 \
287 403 +;percentID=90.6;sequence=GATCTGGC...
chr4-04 EST_Human nucleotide_match 79195 79323 121.000000 + . Target=AI095103.1 \
326 454 +;percentID=96.9;sequence=TTTAAATT...
chr4-04 ensembl_variation deletion 80798 80799 . + . Name=rs60725655;url=http%3A\
%2F%2Fwww.ensembl.org%2FHomo_sapiens%2FVariation%2FSummary%3Fv%3Drs60725655;vari\
ant_sequence=AA-;
chr4-04 Augustus mRNA 119534 119941 . - . ID=transcript21;Name=AUGUSTUS00000051712
chr4-04 Augustus exon 119534 119941 . - . Parent=transcript21
chr4-04 Augustus CDS 119534 119941 . - 0 Parent=transcript21

The Dotter Windows
The dot-plot window
The main Dotter window contains the dot-matrix plot. It also shows any exons for the sequences
along the bottom of the window (for the horizontal sequence; or along the right-hand-side for the
vertical sequence).
Note that the narrow red-shaded border around the edge of the plot indicates the region where the
dot-plot cannot be calculated due to the sliding window averaging method that is used to calculate
the scores.
Cross-hair
The blue cross-hair shows the coordinates at a particular position. It can be moved by clicking/dragging with the left mouse button, or by using the following keyboard shortcuts:
Left-arrow
Move one dot left/right along the horizontal sequence.
Right-arrow

7

Figure 2: The main window

8

Figure 3: Alignment tool - nucleotide->nucleotide mode
Shift-Left
Shift-Right

The same as Left/Right, but for protein sequences this moves by a
single nucleotide coordinate rather than a whole dot/amino-acid.

Up-arrow
Down-arrow

Move one dot up/down along the vertical sequence.

Shift-Up
Shift-Down

The same as Up/Down, but for protein sequences this moves by a
single nucleotide coordinate rather than a whole dot/amino-acid.

,
.

Move diagonally up-left or down-right.
alignment.

<
>

Move diagonally up-left or down-right but, for protein sequences, move
by a single nucleotide coordinate rather than a whole amino-acid.

[
]

Move diagonally down-left or up-right.
alignment.

{
}

Move diagonally down-left or up-right but, for protein sequences, move
by a single nucleotide coordinate rather than a whole amino-acid.

Useful for moving along an

Useful for moving along an

Zoom in with a child Dotter
You can open a new child Dotter on a particular region from the current Dotter window. Middleclick and drag the mouse to select the region to open the new Dotter on.

The alignment tool
The alignment tool shows the portions of the two sequences at the current cross-hair position. The
sequences will move to remain centred on the cross-hair coordinates when the cross-hair is moved.
The same shortcut keys for moving the cross-hair can be used in this window.
Aligning matches are highlighted and colour-coded according to whether they are an exact or conserved match (cyan for exact, violet for conserved).
In nucleotide->nucleotide mode, both strands of the horizontal sequence are shown in the alignment
tool. In nucleotide->protein mode, all three reading frames of the horizontal sequence are shown,
and the best match out of the three frames determines the highlight colour for the bases in the
vertical sequence.
If closed or hidden, the alignment tool can be shown with the 'Ctrl-A' shortcut or by selecting the
'Alignment tool' option under the 'View' menu.

9

Figure 4: Alignment tool - nucleotide->protein mode
Alignment tool menu
Right-clicking in the alignment tool brings up a context menu with the following options:

10

Figure 5: Alignment tool menu
Copy horizontal coord Copy the current horizontal-sequence coordinate to the clipboard
Copy vertical coord

Copy the current vertical-sequence coordinate to the clipboard

Close tool

Close the alignment tool window (it can be re-opened with CtrlA)

Print

Print the alignment tool window

Set alignment Left

Control how long a portion of the sequences should be shown
in the alignment tool.

Alignment tool shortcuts
The keyboard shortcuts for moving the cross-hair also apply in the alignment tool window.

Greyramp tool
This tool controls the threshold and contrast of the the dot-plot image. To improve visualization,
little peaks (noise) can be nullified by a minimum cut-off. Similarly, significant peaks above a
certain score can be saturated by a maximum cut-off.
Drag the square handle and the arrows to change the threshold and contrast. The 'Swap' button
swaps the positions of the top and bottom arrows, inverting the colours. The 'Undo' button undoes
the effect of the last drag.
If closed or hidden, the greyramp tool can be shown with the 'Ctrl-G' shortcut or by selecting the
'Greyramp tool' option under the 'View' menu.

Main menu
The main menu can be accessed via the menu-bar at the top of the dot-plot window or by rightclicking in the dot-plot window.
Note that menus with a dotted line at the top can be “torn off” by clicking on the dotted line. A
torn-off menu will stay visible on top of the Dotter window and can be repositioned by dragging its
header bar. Click the dotted line again to get rid of it.

File menu

11

Figure 6: Greyramp tool

Figure 7: Tear-off menus

12

Figure 8: File menu

Figure 9: Edit menu
Save plot

Save the current dot-plot. It can be re-loaded by calling Dotter from the
command line using the -l argument. Note that you will need to call
Dotter with the same portion of each sequence that was originally passed
to Dotter in order for the alignment tool to function correctly when you
load the dot-plot.

Export plot Export the plot to PDF format. Note that other formats are also available
from the Print menu by selecting Print to File from the print dialog.
Print

Print the current dot-plot.

Use
print Change to a colour-scheme that is more suitable for printing.
colours
Close

Close the current Dotter window. Also closes the associated alignment
and greyramp tool, but does not close any other Dotter windows.

Quit

Close the current Dotter window and all associated Dotters as well (including any child or parent Dotters). If you just wish to close the current
Dotter, then use the 'Close' menu option instead.

Edit menu
Copy horizontal coord Copy the current horizontal-sequence coordinate to the clipboard
Copy vertical coord

13

Copy the current vertical-sequence coordinate to the clipboard

Figure 10: View menu
Settings

Show the 'Settings' dialog.

View menu
Greyramp tool Show the greyramp tool.
Alignment tool Show the alignment tool.
Crosshair

Toggle visibility of the cross-hair

Crosshair label Toggle visibility of the cross-hair label (only has an effect if the crosshair is visible).
Crosshair
fullscreen

Toggle whether the cross-hair is shown to its full extents or is clipped
to just the dot-plot area.

Pixelmap

Toggle visibility of the grey-scale dot-plot image.

Gridlines

Toggle visibility of gridlines.

HSPs off

Select this option to turn HSP (High Scoring Pair) mode off.

Draw
HSPs Select this option to view HSPs in grey-scale mode. In this mode,
(greyramp)
the HSPs (High Scoring Pairs) are drawn in a shade of grey that is
determined by their score. The greyramp tool can be used to adjust
the thresholds and contrast of the HSP image. This mode replaces the
standard dot-plot image.

14

Figure 11: Help menu
Draw
HSPs Select this option to view all HSPs as red lines. This mode can be used
(red lines)
in conjunction with the standard dot-plot image: HSPs are drawn over
the top.
Draw
HSPs Select this option to view HSPs as solid lines, whose colour depends on
(color=f(score)) their score. This mode can be used in conjunction with the standard
dot-plot image: HSPs are drawn over the top.
Bump exons

Expand the transcript display so that exons do not overlap.

Help menu
Help

Show the 'Help' dialog.

About

Show the 'About' dialog.

Settings
The settings dialog can be accessed by selecting the 'Settings' option on the 'Edit' menu, or by
pressing the 'Ctrl-S' shortcut key.
Zoom
Specify the zoom factor. The factor is an inverse: a zoom factor of 3 will zoom out by a factor of
3, i.e. the window will shrink to 1/3 of its full size. A zoom factor of 1 will show the window at
full size. A factor of less than 1 (e.g. 0.5) can be set in order to zoom in, but this will result in a
stretched dot-plot so is not recommended.
Horizontal range
Set the range of the horizontal sequence. The maximum range possible is the range that was
originally passed to Dotter – the range you enter will be trimmed if you enter out-of-range values.
Note that this causes the matrix to be recalculated, so if it took a long time to calculate in the first
place, stay away from this menu item!
Vertical range
Set the range of the vertical sequence. The maximum range possible is the range that was originally
passed to Dotter – the range you enter will be trimmed if you enter out-of-range values.
Note that this causes the matrix to be recalculated, so if it took a long time to calculate in the first
place, stay away from this menu item!

15

Figure 12: The Settings dialog
Sliding window size
To make the score matrix more intelligible, the pairwise scores are averaged over a sliding window
that runs diagonally. This option allows you to edit the size of the sliding window. There's normally
no need to change this.
Note that this causes the matrix to be recalculated, so if it took a long time to calculate in the first
place, stay away from this menu item!
Highlight splice sites
When this option is enabled, splice-sites for known high-scoring pairs will be highlighted in the
alignment view. The dinucleotide will be highlighted in green for a canonical splice-site and red for
non-canonical.
Show break-lines
Tick this option to display break-lines between different sequences when Dottering multiple sequences
(i.e. where there are multiple sequences in the same FASTA input file). This option will be greyed
out if there is only one sequence per input file.
Show horizontal sequence labels
When break-lines are enabled, tick this option show labels for each break-line for the horizontal
sequence.
Show vertical sequence labels

16

When break-lines are enabled, tick this option show labels for each break-line for the vertical sequence.

Keyboard shortcuts
Left-arrow
Move the cross-hair one dot left/right along the horizontal sequence.
Right-arrow
Shift-Left
Shift-Right

The same as Left/Right, but for protein sequences this moves by a single
nucleotide coordinate rather than a whole dot/amino-acid.

Up-arrow
Move the cross-hair one dot up/down along the vertical sequence.
Down-arrow
Shift-Up
Shift-Down

The same as Up/Down, but for protein sequences this moves by a single
nucleotide coordinate rather than a whole dot/amino-acid.

,
.

Move diagonally up-left or down-right. Useful for moving along an alignment.

<
>

Move diagonally up-left or down-right but, for protein sequences, move by a
single nucleotide coordinate rather than a whole amino-acid.

[
]

Move diagonally down-left or up-right. Useful for moving along an alignment.

{
}

Move diagonally down-left or up-right but, for protein sequences, move by a
single nucleotide coordinate rather than a whole amino-acid.

Ctrl-W

Close the current window. If this is a dot-plot window, it also closes the
associated alignment and greyramp tool.

Ctrl-Q

Quit Dotter.
Dotters.

Ctrl-S

Open the Settings dialog.

Ctrl-P

Print the Dotter window.

Ctrl-H

Open the Help dialog.

Ctrl-A

Show the alignment tool.

Ctrl-G

Show the greyramp tool.

Ctrl-D

Show the main dot-plot window.

B

Bump exons.

17

Also quits any associated Dotters, i.e. any child or parent



---

Source Exif Data:

File Type                       : PDF
File Type Extension             : pdf
MIME Type                       : application/pdf
PDF Version                     : 1.5
Linearized                      : No
Page Count                      : 17
Page Mode                       : UseOutlines
Author                          : Gemma Barson
Title                           : Dotter User Manual
Subject                         : 
Creator                         : LaTeX with hyperref package
Producer                        : pdfTeX-1.40.14
Create Date                     : 2014:04:17 11:23:36+01:00
Modify Date                     : 2014:04:17 11:23:36+01:00
Trapped                         : False
PTEX Fullbanner                 : This is pdfTeX, Version 3.1415926-2.5-1.40.14 (TeX Live 2013) kpathsea version 6.1.1

EXIF Metadata provided by EXIF.tools