NGS Sequencer Guide

User Manual:

Open the PDF directly: View PDF .
Page Count: 48

Sequencing set-up guidelines for NGS

libraries prepped with Agilent NGS kits

I. Illumina Instruments (SureSelectXT/XT2/QXT, SurSelect

RNA-Seq and HaloPlex/HaloPlexHS)

II. ION Instruments (SureSelectXT and HaloPlex/HaloPlexHS)

1. HiSeq1000/2000 and HiSeq1500/2500

1) Planning a run using IEM (Illumina Experiment Manager)

2) Starting a run in the HCS (HiSeq Control Software) user interface

2. MiSeq

1) Planning a run using IEM

2) Starting a run in the MCS (MiSeq Control Software) user interface

3. NextSeq

1) Planning a run

A. Using IEM (standalone mode)

B. Using BaseSpace

2) Starting a run in the NCS (NextSeq Control Software) user interface

1. Planning a run and reanalyzing a run using the Torrent Server

(applies to PGM, Proton and S5)

2. Starting a run on an ION Instrument

1. bcl to fastq conversion for Illumina sequencing

2. Example sample sheet and other template csv ﬁles

A. Example sample sheet

a XT/XT2/RNA-Seq/HaloPlex

b. QXT without adapter trimming

c. QXT with adapter trimming

e. QXT with custom primer and adapter trimming options

e. HaloPlexHS

B. Library prep kit template csv ﬁle for BaseSpace

a XT/XT2/RNA-Seq/HaloPlex

b. HaloPlexHS

c. QXT without adapter trimming

e. QXT with custom primer and adapter trimming options

3. How to add Agilent library prep kits as custom Library Prep Kit types in IEM

4. Illumina sequencing reagent kit selection guide

5. Recommended seeding concentrations for Illumina sequencing

6. How to convert an Agilent BED ﬁle into a manifest ﬁle

7. Considerations for PhiX spike-in

ION SEQUENCING-RELATED

8. ION reagent kits used by Agilent for template preparation and sequencing

9. Seeding concentration for ION sequencing and ION sphere QC

10. How to modify an Agilent BED ﬁle to be uploaded to the Ion Server

Sequencing set-up guidelines for NGS

libraries prepped with Agilent NGS kits

III. Appendices

Sequencing set-up guidelines for NGS

libraries prepped with Agilent NGS kits

1. Only works with standalone machines and cannot be set up through BaseSpace

2. When using the MiSeq, the MiSeq Reporter software can be reconﬁgured to generate

the additional I2 fastq ﬁle e.g. the molecular barcode ﬁle. Please refer to the “Additional

MiSeq Platform sequencing run setup requirements” in the HaloPlexHS protocol. In any

other situation, the HaloPlexHS data will need to be converted ofﬂine using the bcl2fastq

software or Picard tool. Please refer to Appendix 1B for details.

* Versions of software demonstrated in this document:

IEM v1.11.0

HiSeq Control Software v2.2.68

MiSeq Control Software v2.6.2.1

NextSeq Control Software v2.0.2

Torrent Server v5.0.4

Important notes for HaloPlexHS (Illumina):

Choose “HiSeq/HiScanSQ/GA.”

Choose the sequencer that will

be used.

Choose “HiSeq FASTQ Only.”

Click “Create Sample Sheet.”

Planning a run on the HiSeq 2000/2500

using IEM for Agilent NGS libraries

I.1.1.

Planning a run on the HiSeq 2000/2500

using IEM for Agilent NGS libraries

I.1.1.

Fill in the ﬁelds for: Reagent Kit Barcode, Experiment

Name, Investigator Name, and Description. Paired

End sequencing is recommended for all Agilent

NGS libraries.

For SureSelectXT/XT2/RNA-Seq: Choose TruSeq LT as the Library Prep Kit.

Choose TruSeq LT as the Library Prep Kit. If you are following the shearing size of 150-bp to 200-bp and using a

100-bp or shorter read length, adapter trimming is not necessary. If you are using shorter shearing size or

longer read length and prefer to have Illumina software do the trimming, check the adapter-trimming options.

Otherwise, uncheck these two options and trim adapters later using Agilent SureCall software or the AGeNT toolkit.

For QXT: Choose Nextera XT and either:

(1) leave “Use Adapter Trimming” checked or (2) uncheck this option and trim the adapter using SureCall

or the AGeNT toolkit. Trimming with SureCall or the AGeNT toolkit is recommended.

If you choose the “Use Adapter Trimming” option, you will need to enter the consensus sequence for the

QXT adapters provided in the QXT protocol (CTGTCTCTTGATCACA), when you edit the sample sheet later.

Leave the three “Custom Primer” options unchecked; spike the Agilent read primers into the Illumina read

primers; and place the primer mixtures in their original positions.

Note: Because of possible reagent ﬁll-volume variabilities, we recommend pipetting the appropriate

volumes of the Illumina read primers out of their original tubes and mixing them with required volumes

of the respective QXT read primers in separate tubes. Refer to the QXT protocol/custom primer-preparation

tables for details.) Then place the primer mixtures at positions corresponding to the relevant Illumina read

primers on the reagent rack.

For HaloPlex: Choose TruSeq LT, but uncheck the adapter-trimming option and perform

trimming in SureCall or using the AGeNT toolkit.

For HaloPlexHS: Choose Nextera XT and uncheck “Use Adapter Trimming.”

Planning a run on the HiSeq 2000/2500

using IEM for Agilent NGS libraries

I.1.1.

Note for HaloPlexHS:

Index 2 is the molecular barcode and is not used

for demultiplexing. Use 10 “N”s for index 2 for

all samples in the sample sheet. You will need

to perform ofﬂine bcl-to-fastq conversion to

demultiplex using only index 1. In the meantime,

generate a fastq ﬁle for index 2; the fastq ﬁle will

be needed for HaloPlexHS data analysis. Please

refer to Appendix 1 for more instructions.

Click “Add Blank Row” for each sample.

Fill in the ﬁelds for: Sample ID and Sample

Name. It does not matter what you select for

the index at this time, because you will edit

the sample sheet to enter the correct index

sequences. Click “Finish” to save the sample

sheet. The screen below is single-indexed for

demonstration purposes only.

When asked, “Would you like to view

your sample sheet in Excel?”click “Yes.

Then enter the correct sample index names

and sequences and save the sample sheet.

Copy or move the sample-sheet csv ﬁle to the

appropriate location on your HiSeq, if you ran

IEM on a different computer. Refer to Appendix

2A for example sample sheets of respective

library types.

Planning a run on the HiSeq 2000/2500

using IEM for Agilent NGS libraries

I.1.1.

Alternatively, you may create a sample plate ﬁrst and then use

the sample plate to generate a sample sheet.

n Open IEM and click “Create Sample Plate.”

n On the Library Prep Kit Selection page, choose a Library Prep

Kit for your Agilent Libraries as stated above, e.g., “TruSeq LT” for

the single-indexed SureSelectXT/XT2/RNA-Seq and HaloPlex,

and “Nextera XT” for the dual-indexed QXT and HaloPlexHS

n Enter the plate name and choose the appropriate index

conﬁguration.

n Enter your sample information from the “Table” view. Similarly,

choose any index from the drop-down list for now, and the

correct index will be entered when you edit the sample sheet

later (as described above).

n After sample information has been entered in the Table view,

the Plate and Plate Graphic views will automatically populate.

Click “Finish.”

n Go back to the IEM root page and click “Create Sample

Sheet” > “HiSeq/HiScanSQ/GA” > your sequencer> “HiSeq

FASTQ Only.”

n Follow the instructions for the Sample Sheet Wizard – Workﬂow

Parameters page (see above).

n On the Sample Selection page, uncheck the “Maximize” option

to bring the sample-plate view and sample-sheet view onto

the same page, and then click “Select Plate” to navigate to a

sample plate that you created. Note: If you don’t see the plate

ﬁle that you intend to import, it might be because the Library

Prep Kit does not match the one chosen when creating the

sample plate.

n You can also use the “New Plate” option to create a sample

plate here. Either highlight part of the sample plate or click

“Select All” and then click “Add Selected Samples” to move

the samples to the sample sheet. Click “Finish” and save the

sample sheet.

Click “Yes” when you are prompted with the below question,

and edit the index names and sequences.

Note: For QXT, refer to the SureSelectQXT protocol for custom-primer

spike-in guidelines.

For HiSeq 2500/1500 models that support Rapid Mode, the user interface

bifurcates at the beginning for High Output Mode and Rapid Mode. The

below screen captures are based on Rapid Mode on the HiSeq 2500.

Start the Rapid Mode workﬂow.

Note that the example on the

left has clusters generated on

a cBot, and the one on the right

represents on-board cluster

generation.

Perform volume check.

Check integration options.

Starting a run in the HiSeq

Control Software user interface

I.1.2.

Flow-cell setup.

Choose storage options.

Advanced settings.

Fill in the recipe. Index type

and number of cycles must

align with the libraries to be

sequenced. The examples in

the below screen are QXT on

the left and XT on the right.

Starting a run in the HiSeq

Control Software user interface

I.1.2.

Enter SBS Kit ID and Cluster Kit ID.

Choose the cluster-generation

option and select the sample

sheet.

Load reagents.

Load the ﬂow cells, e.g., the

priming ﬂow cell on the left for

clusters generated on a cBot

and the sequencing ﬂow cell on

the right for on-board cluster

generation.

Starting a run in the HiSeq

Control Software user interface

I.1.2.

Starting a run in the HiSeq

Control Software user interface

I.1.2.

Close the door and allow the

machine to read the ﬂow-cell

barcode.

Fluidics check.

Start the run.

The run starts.

On the next screen (Instrument

Selection), choose “MiSeq.”

Click “Create Sample Sheet.”

On the MiSeq Application

Selection page, we recommend

selecting “Other” as the category

and “FASTQ Only” as the

application.

I.2.1. Planning a run on the MiSeq using

IEM for Agilent NGS libraries

I.2.1. Planning a run on the MiSeq using

IEM for Agilent NGS libraries

On the next screen, ﬁll in the ﬁelds for: Barcode, Experiment Name, Investigator Name,

and Description. Specify selections for Library Prep Kit, Read Type, Cycles Read 1, and

Cycles Read 2. You may set Cycles Read 1 and Cycles Read 2 to values based on your

application needs and cartridge capacity.

For SureSelectXT/XT2/RNA-Seq: Choose TruSeq LT as the Library Prep Kit.

If you are following the shearing size of 150-bp to 200-bp, and using 100-bp or shorter read length, adapter

trimming is not necessary. If you are using shorter shearing size or longer read length and prefer to have

Illumina software do the trimming, check the adapter-trimming option. Otherwise, uncheck these two

options and trim adapters later using Agilent SureCall software or the AGeNT trimming tool.

For QXT: Choose Nextera XT and either:

(1) leave “Use Adapter Trimming” checked or (2) (recommended) uncheck this option to trim the adapter

using SureCall or the AGeNT toolkit.

If you choose the “Use Adapter Trimming” option, you will need to enter the consensus sequence for the

QXT adapters provided in the QXT protocol (CTGTCTCTTGATCACA) when you edit the sample sheet.

For HaloPlex: Choose TruSeq LT, but uncheck the adaptor-trimming option and perform

trimming in SureCall or using the AGeNT toolkit.

You have two options for placing the QXT read-primer mixtures, and this

determines whether you need to check the “Custom Primer” options on

this screen.

I.2.1. Planning a run on the MiSeq using

IEM for Agilent NGS libraries

OPTION 1 OPTION 2

If you combine the Agilent QXT

read primers with the Illumina

read primers from wells 12, 13,

and 14 and then move the primer

mixtures to wells 18, 19, and 20

in the cartridge (see QXT protocol

for instructions), you should check

all three “Custom Primer” options.

This instructs the MiSeq sippers

to draw primers from the custom

primer wells, e.g., 18, 19, and 20.

Please note that the well positions

do not match the Illumina names

(i.e., HP10 is in position 12).

You can draw the Illumina read

primers out and mix with the

Agilent QXT read primers in clean

tubes, place the primer mixtures

back in the respective original

Illumina read primer positions,

and leave the three “Custom

Primer” options unchecked.

For HaloPlexHS: Choose Nextera

XT and uncheck the Use Adaptor

Trimming option.

I.2.1. Planning a run on the MiSeq using

IEM for Agilent NGS libraries

Click “Next” to proceed to the Sample Selection screen.

Add a blank row for each sample. Fill in the SampleID,

Sample Name, and Plate ﬁelds. At this point, you can

specify any index and then change it when you edit the

sample sheet later. The screen below is single-index for

demonstration purposes only.

n Click “Finish” to save the sample sheet.

When prompted, if you wish to open the sample sheet in

Excel, click “Yes.” Then enter the correct sample index

names and sequences and save the sample sheet. Copy or

move the sample-sheet csv ﬁle to the appropriate location

on your HiSeq, if you ran IEM on a different computer. Refer

to Appendix 2A for example sample sheets of respective

library types.

Note for HaloPlexHS:

Index 2 is the molecular barcode and is not used for

demultiplexing. Use 10 “N”s for index 2 for all samples

in the sample sheet. You would demultiplex HaloPlexHS

sequencing data using only index 1 and would need to

generate the index 2 fastq ﬁles in addition to the paired-end

read fastq ﬁles for data analysis. To do this, you can either

modify the conﬁguration of the MiSeq Reporter software

or perform ofﬂine bcl-to-fastq conversion. Please refer to

Appendix 1 for instructions.

I.2.1. Planning a run on the MiSeq using

IEM for Agilent NGS libraries

Alternatively, you may create a sample plate ﬁrst and then

use the sample plate to generate a sample sheet.

n Open IEM and click “Create Sample Plate.”

n On the Library Prep Kit Selection page, choose a kit for your

Agilent Libraries, e.g., “TruSeq LT” for the single-indexed

SureSelectXT/XT2 and HaloPlex, and “Nextera XT” for the

dual-indexed QXT and HaloPlexHS

n Enter the plate name and choose the appropriate index

conﬁguration.

n Enter your sample information from the Table view. Similarly,

choose any index from the drop-down list for now, and the

correct index will be entered when you edit the sample sheet

later (as described above).

n After sample information has been entered in Table view,

the Plate and Plate Graphic views will automatically

populate. Click “Finish.”

n Go back to the IEM root page and click “Create Sample

Sheet” > “MiSeq” > “FASTQ Only.”

n Follow the instructions for the Sample Sheet Wizard – Workﬂow

Parameters page (see above).

n On the Sample Selection page, uncheck the “Maximize”

option to bring the sample-plate view and sample sheet

view onto the same page, and then click “Select Plate”

to navigate to a sample plate that you created.

Note for HaloPlexHS:

If you don’t see the plate ﬁle that you intend to import, it might

be because the Library Prep Kit does not match the one chosen

when creating the sample plate.

n You can also use the “New Plate” option to create a sample

plate. Either highlight part of the sample plate or click “Select

All” and then click “Add Selected Samples” to move the

samples to the sample sheet. Click “Finish” and save the

sample sheet.

n Click “Yes” when you are prompted with the below question,

and edit the index names and sequences.

Click “SEQUENCE.”

Choose or leave unchecked the

“BaseSpace” option and follow

the workﬂow provided by the

software.

Load the ﬂow cell as guided.

Note: For QXT, refer to the SureSelectQXT protocol for custom-primer

spike-in guidelines.

Starting a run in the MiSeq

Control Software user interface

I.2.2.

Load the reagent cartridge.

Load the waste bottle.

When you click “Change Sample

Sheet” on the “Please load the

reagent cartridge” screen, it

brings you to the screen below.

Navigate to the sample sheet

(csv ﬁle) by clicking “Browse.”

After clicking on “Save and

Continue,” you are brought back

to the previous screen (“Please

load the reagent cartridge.”).

Click “Next.”

Starting a run in the MiSeq

Control Software user interface

I.2.2.

Starting a run in the MiSeq

Control Software user interface

I.2.2.

The instrument performs

a pre-run check.

The run starts.

Review the run setup.

The pre-run check completes.

Open IEM, click “Create

Sample Sheet”

“NextSeq”

“FASTQ Only.”

Planning a run using IEM

Planning a run on the NextSeq

for Agilent NGS libraries

I.3.1.

On the Sample Sheet Wizard - Workﬂow Parameters

page, enter Reagent Kit Barcode, Experiment Name,

Investigator Name, and Description. Paired-end

sequencing is recommended for all Agilent

NGS libraries.

For XT/XT2/RNA-Seq, choose TruSeq LT as the Library Prep Kit.

If you are following the shearing size of 150-bp to 200-bp and using 100-bp or shorter read

length, adapter trimming is not necessary. If you are using shorter shearing size or longer

read length and prefer to have Illumina software do the trimming, check the adapter-

trimming option. Otherwise, uncheck these two options and trim adapters later using

Agilent SureCall software or the AGeNT trimming tool.

For HaloPlex: Choose TruSeq LT, but uncheck the adaptor trimming options and perform

trimming in SureCall or using the AGeNT toolkit.

For HaloPlexHS: Choose Nextera XT and uncheck “Use Adaptor Trimming.”

For QXT: Choose Nextera XT and either:

(1) leave “Use Adapter Trimming” checked or (2) uncheck this option to trim the adapter

using SureCall or the AGeNT toolkit. Trimming with SureCall or the AGeNT toolkit is

recommended.

If you choose the “Use Adapter Trimming” option, you will need to enter the consensus

sequence for the QXT adapters provided in the QXT protocol (CTGTCTCTTGATCACA),

when you edit the sample sheet.

Planning a run on the NextSeq

for Agilent NGS libraries

I.3.1.

Planning a run on the NextSeq

for Agilent NGS libraries

I.3.1.

On the Sample Selection page, click “Add Blank Row”

to add rows and ﬁll in the sample information. You may

choose any index from the drop-down list (same for dual-

indexed samples) at this time. The correct indexes will be

entered when you edit the sample sheet later. The screen

below is single-indexed for demonstration purposes only.

When all sample information is entered, click “Finish”

and save the sample sheet. When prompted with the below

question, click “Yes.” When the sample sheet opens, enter

the actual index names and sequences used. Save the edited

sample sheet to the original location.

Note: For HaloPlexHS

, index 2 is the molecular barcode and

will not be used for demultiplexing. Use 10 “N”s for index 2

for all samples in the sample sheet. You will need to perform

ofﬂine bcl-to-fastq conversion to demultiplex using only

index1. In the meantime, generate a fastq ﬁle for index 2; the

fastq ﬁle will be needed for HaloPlexHS data analysis. Please

refer to Appendix 1 for more instructions. For QXT, refer to

the P5 index sequence table speciﬁc to NextSeq in the QXT

protocol, as the index sequences must be entered as the

reverse complement of those used for the HiSeq 2000/2500

and the MiSeq.

Planning a run on the NextSeq

for Agilent NGS libraries

I.3.1.

Alternatively, you may create a sample plate ﬁrst and then

use the sample plate to generate a sample sheet.

n Open IEM and click “Create Sample Plate.”

n On the Library Prep Kit Selection page, choose a Library

Prep Kit for your Agilent Libraries as stated above,

e.g., “TruSeq LT” for the single-indexed SureSelectXT/XT2/

RNA-Seq and HaloPlex, and “Nextera XT” for the dual-

indexed QXT and HaloPlexHS

n Enter the plate name and choose the appropriate index

conﬁguration.

n Enter your sample information from the Table view. The

columns with * are required ﬁelds. Similarly, choose any

index from the drop-down list for now, and the correct

index will be entered when you edit the sample sheet

later (as described above).

n After sample information has been entered in Table view,

the Plate and Plate Graphic views will automatically

populate. Click “Finish.”

n Go back to the IEM root page and click “Create Sample

Sheet” > “NextSeq” > “FASTQ Only.”

Follow the instructions for the “Sample Sheet Wizard -

Workﬂow Parameters page” (see above).

n On the Sample Selection Page, uncheck the “Maximize”

option to bring the sample-plate view and sample-sheet

view onto the same page, and then click “Select Plate” to

navigate to a sample plate that you created. Note: If you

don’t see the plate ﬁle that you intend to import, it might

be because the Library Prep Kit does not match the one

chosen when creating the sample plate.

n You can also use the “New Plate” option to create a

sample plate. Either highlight part of the sample plate or

click “Select All” and then click “Add Selected Samples”

to move the samples to the sample sheet. Click “Finish”

and save the sample sheet.

n Click “Yes” when you are prompted with the question

“Would you like to view your sample sheet in Excel?”

and then edit the index names and sequences.

Log into BaseSpace and then go to

PREP > Biological Samples > Create.

Click “+ Custom Library Prep Kit.”

TO ADD SAMPLES INDIVIDUALLY

Planning a run using BaseSpace

*You can either add samples and then add library information (e.g., plan for index usage on the

samples) or import prepared libraries in one step.

Planning a run on the NextSeq

for Agilent NGS libraries

I.3.1.

Enter biological samples one by one, and then choose/check the samples to process with “Prep Libraries.”

Note for QXT: Because BaseSpace automatically converts the P5 indexes to reverse complement sequences, the

P5 index sequences in the QXT LibraryPrepKit template ﬁle that we provide are not reverse complement.

TO ADD SAMPLES INDIVIDUALLY (cont.)

Planning a run on the NextSeq

for Agilent NGS libraries

I.3.1.

Choose the desired Library Prep Kit in the drop-down list, enter a Plate ID, and click “Auto Prep” to

populate the wells and assign indexes to each sample. You can also check the boxes in front of a

sample and drag it to a well.

Proceed to “Pool Libraries” and “Plan Run” following the BaseSpace workﬂow. A new run will appear

in the list of “Planned Runs.” Check the run you want to sequence, and click “Sequence.” This run will

be ready for sequence and can be retrieved in NCS.

Describe the new Custom Library

Prep Kit in the pop-up window.

Upload the QXT, XT/XT2/RNA-

Seq, or HaloPlex LibraryPrepKit

template .csv ﬁle (available in the

appendices). This will generate a

corresponding Library Prep Kit in

the “Library Prep Kit” drop-down

list. Note 100-bp read length is

shown for demonstration only.

Go to PREP > Libraries.

Import the sample library csv ﬁle corresponding to your library type (XT/XT2, QXT, or HaloPlex). You

can download a template from here. Note: The name given in the “LibraryPrepKit” ﬁeld in the csv ﬁle

must exactly match an existing Library Prep Kit (either by Illumina default or created by you), and the

[Header] line cannot be blank.

TO ADD A SAMPLE LIBRARY FILE (e.g. with indexes added/assigned)

A link to download a template is provided in

the import window.

Planning a run on the NextSeq

for Agilent NGS libraries

I.3.1.

Planning a run on the NextSeq

for Agilent NGS libraries

I.3.1.

The samples in the csv ﬁle will populate in a plate.

TO ADD A SAMPLE LIBRARY FILE (cont.)

Proceed to “Pool Libraries” and “Plan Run” following the BaseSpace workﬂow. A new run will appear

in the list of “Planned Runs.” Check the run you want to sequence, and click “Sequence.” This run will

be ready for sequencing and can be retrieved in NCS.

Click “SEQUENCE” and follow

the workﬂow provided by the

software.

On BaseSpace- and BaseSpace

Onsite-conﬁgured machines,

you will log into BaseSpace

after clicking “Sequence.”

Standalone machines proceed

to “Load.”

The instrument scans the

ﬂow-cell ID and checks the

ﬂow-cell sensor.

Note:

1. The screen shots shown in this section are from a run on a stand-alone machine.

2. For QXT, refer to the SureSelectQXT protocol for custom-primer spike-in guidelines.

I.3.2. Starting a run in the NextSeq

Control Software user interface

Empty the spent reagent

cartridge and load the buffer

cartridge.

Load the reagent cartridge.

Conﬁrm the reagent cartridge ID.

I.3.2. Starting a run in the NextSeq

Control Software user interface

Starting a run in the NextSeq

Control Software user interface

I.3.2.

On BaseSpace- and BaseSpace Onsite-conﬁgured machines, you will be provided

with a screen where you can select a run planned on BaseSpace at the “Run Setup”

step before the run parameter screen shown below.

Use the parameters in this table for your Agilent NGS libraries.

Read Type Index Type Read Length Index 1 Read Length Index 2 Read Length Custom Primers

XT/XT2 Paired End single 2x 75/2x100/2x150 bp

QXT Paired End dual 2x 75/2x100/2x150 bp

8 8 Check all 3

HaloPlex Paired End single 2x100 or 2x150 bp

depending on design

HaloPlex

* Paired End dual 2x100 or 2x150 bp

depending on design

8 10 No

The run starts.

*HaloPlexHS can only be set up

on stand-alone machines.

Notes:

n The demonstration of Torrent Server is based on v5.0.4.

n This section should apply to PGM, Proton, and S5, although these settings had not

been validated on the S5 when this document was completed.

n We recommend analyzing sequencing data from the Torrent Server and associated

BAM ﬁles with Agilent SureCall software.

n HaloPlexHS data must be reanalyzed to enable modiﬁed adapter trimming.

Go to the Reference page by clicking on the gear

icon in the upper right corner.

Add reference genome and target region BED ﬁle

(the covered.BED ﬁle of your design).

When ﬁrst sequencing HaloPlex or HaloPlexHS

libraries on the ION instrument, deﬁne the

HaloPlex-speciﬁc 3’-adapter sequence as a

custom 3’-adapter on the Torrent Server.

Go to http://ionserver/admin/rundb/

threeprimeadapter/add/ and add

GCTGAGGATCACCGACTGCCCATAGAGAGGCTGAGA

in the “Sequence” ﬁeld. Name it as you see ﬁt,

and save.

PLANNING A RUN ON THE TORRENT SERVER

Add genome and ROI

II.1.

Planning a run and reanalyzing a run

in the Torrent Server for AgilentXT and

HaloPlex/HaloPlexHS libraries

Go to the “Plan” tab, click “Templates” > “Generic Sequencing” > “Plan New Run.”

n Use default settings under the IonReporter and

Application tabs.

n Specify kits, 3’ adapter, and barcode set under the

Kits tab.

Leave the Sample Prep Kit and Library Prep Type ﬁelds

blank. For HaloPlex/HaloPlexHS

, click “Details,” and

change the 3' Adapter to the one that you deﬁned

above (A.1). For SureSelect, use the default 3' Adapter

ION P1B. Specify the “Chip Type,” “Template Kit,”

and “Sequencing Kit” you are using, and choose

“IonXpress” barcode set for all Agilent kits.

n Plug-ins are optional. We currently have not

validated any pre-installed plug-ins and recommend

that you run without plug-ins and use SureCall

for analysis.

n Complete the Projects and Plan sections. This

will create a new run under “Planned Run List”

and can be navigated from the touch screen of

the sequencer linked to your Torrent Server. The

Monitor tab lets you monitor the status on the Ion

Chef or the associated sequencing instrument under

“Runs in Progress.”

II.1.

Planning a run and reanalyzing a run

in the Torrent Server for AgilentXT and

HaloPlex/HaloPlexHS libraries

PLAN A RUN

Reanalyzing a run on the Torrent Server

A completed run can be reanalyzed and analysis parameters can be modiﬁed when reanalyzing.

Note: HaloPlexHS data must be reanalyzed to trim an additional 15 bases from the 3 prime.

II.1.

Planning a run and reanalyzing a run

in the Torrent Server for AgilentXT and

HaloPlex/HaloPlexHS libraries

Go to “Data” > “Completed Run & Results.” Click the gear icon (far right)

of the run you want to reanalyze and choose “Reanalyze.”

Planning a run and reanalyzing a run

in the Torrent Server for AgilentXT and

HaloPlex/HaloPlexHS libraries

II.1.

Specify the 3' Adapter in the Analysis

Options section. Use the HaloPlex

custom 3' Adapter that was added as

described above (see A. 1) for HaloPlex

or HaloPlexHS data, and ION P1B for

SureSelect. No other changes are

needed in “Analysis Options.”

For HaloPlexHS

, choose “Base Calling”

and “Custom.” Click the plus sign

next to “Custom” to bring the detailed

custom settings. Add text “—extra-

trim-left 25” in the BaseCaller ﬁeld,

as shown below.

Specify reference genome, regions BED

ﬁle, and barcode set in the Reference &

Barcoding section. Use IonXpress as the

barcode set for all Agilent libraries.

PLAN A RUN

Plug-ins are optional. We currently have not validated any pre-installed plug-ins and

recommend that you run without plug-ins and use SureCall for analysis. Click “Start.”

II.2. How to start a run on ION

sequencing instruments

Note: There isn’t anything speciﬁc to NGS libraries prepped with the Agilent kit when

launching a planned run on ION sequencing instruments. Follow the ION documentation

to prepare the sequencer and the chip. When a chip is loaded properly, call the planned

run from the touch screen of the sequencer. Below is an example of launching a run

on the ION PGM.*

*The ION PGM touch screen images are adapted from the ION PGM sequencing 200 kit V2 user

guide (Publication Number MAN0007273).

After a run is planned on the Torrent

Server, the run will appear in the

Planned Run List with a unique,

5-digit Run Code.

After the sequencer is properly

initialized and the chip is loaded, click

“Browse,” next to “Planned Run” in

the screen’s header section 5: Select

Planned Run, and then select the run.

Alternatively, enter the Run Code in the

Planned Run ﬁeld. Click “Next.”

The digital protocol associated with

the selected run will populate in the

Run Info section. Verify the settings

and continue, following the software-

guided workﬂow to start the run.

Bcl-to-fastq conversion, along with demultiplexing,

typically is done on the instrument. There are

occasions when ofﬂine conversion may be needed.

A. When a run was not set up properly and lacks critical parameters, such

as when the Library Prep Kit was not speciﬁed. This should be a rare case,

and the conversion can be performed with the Illumina bcl2fastq software

in a standard manner. Download the software from the Illumina website

and consult with Illumina if you need assistance.

III.1. Options for bcl-to-fastq conversion

for Illumina sequencing

1. When sequencing on a MiSeq, you may modify the MiSeq Reporter software conﬁguration for this

purpose; do so before the sequencing run, if the software is installed on a MiSeq workstation. Or

you may reanalyze the data using stand-alone MiSeq Reporter (this way the change will not affect

subsequent sequencing runs).

The instructions on how to modify the MiSeq Reporter conﬁguration can be found in the HaloPlexHS ILM

protocol under “MiSeq platform sequencing run setup guidelines.”

Basically, modify the MiSeq Reporter conﬁguration ﬁle for the instrument that directs the sequencer to

generate a third fastq ﬁle for the molecular barcodes in index 2. The conﬁguration XML ﬁle is usually found

at: C:/Illumina/MiSeq Reporter/MiSeq/Reporter.exe.conﬁg.

The ﬁle must be edited with a text

editor and not with Excel. The

syntax of the line must precisely

match the line shown in the green

box, including the < and > brackets

and quotation marks.

The characters shown in black (CR LF) stand for carriage return and linefeed; they may not be visible in

your editor. Do not change any other lines. You may cut and paste from the line below into a blank line

you’ve inserted into the ﬁle:

Save the ﬁle and restart the instrument for this change to take effect.

NOTE: This change will remain in place for all subsequent runs for all assays. If you are running an assay

other than HaloPlexHS

, you may edit the ﬁle and change the “1” to a “0.”

B. HaloPlexHS users will likely need to do ofﬂine conversion to retrieve the I2 fastq

ﬁle, which contains the molecular barcode reads. Currently, there are three

possible ways to obtain the I2 fastq ﬁle while generating demultiplexed fastq

ﬁles of the paired-end reads.

III.1. Options for bcl-to-fastq conversion

for Illumina sequencing

III.1. Options for bcl-to-fastq conversion

for Illumina sequencing

2. Use Illumina’s bcl2fastq conversion software.

n Use a base mask parameter (“---use-bases-mask Y*,I8,Y10,Y*”), where * represents the read length

n When using v2.17 or a newer version, run it with “--mask-short-adapter-reads 0” so that it doesn’t

delete the index2 read sequence

n Modify the sample sheet to have only the sample index (and not the molecular barcode index) by

clearing the content in the “I5_index_ID” and “index2” columns. The software cannot handle “N”

characters in a barcode sequence.

3. Customers can use Picard tools from the Broad Institute to do bcl-to-fastq conversion, if functional

Illumina software is not available. Below are the commands (using Picard tools 2.4.1 and java 8).

Picard can be downloaded here: http://broadinstitute.github.io/picard/

The tool documentation is here: http://broadinstitute.github.io/picard/command-line-overview.html

Two tools are needed:

ExtractIlluminaBarcodes (to ﬁnd the barcodes)

IlluminaBasecallsToFastq (to generate the fastq ﬁles based on the output of the ﬁrst command)

Here are the commands that have been used at Agilent:

nohup java -jar picard.jar ExtractIlluminaBarcodes BASECALLS_DIR=<sequencing_run_directory>/

Data/Intensities/BaseCalls/ OUTPUT_DIR=<barcode_output_dir_name> LANE=1 READ_

STRUCTURE=<read_structure> BARCODE_FILE=<barcode_ﬁle> METRICS_FILE=<metric_ﬁle_name>

NUM_PROCESSORS=<n> &

nohup java -jar picard.jar IlluminaBasecallsToFastq BASECALLS_DIR=<sequencing_run_directory>/

Data/Intensities/BaseCalls/ LANE=1 BARCODES_DIR=<barcode_output_dir_name> READ_

STRUCTURE=<read_structure> FLOWCELL_BARCODE=<FCID> MACHINE_NAME=<machine_name>

RUN_BARCODE=<run_number> ADAPTERS_TO_CHECK=PAIRED_END

NUM_PROCESSORS=<n> READ_NAME_FORMAT=CASAVA_1_8 COMPRESS_OUTPUTS=true

MULTIPLEX_PARAMS=<multiplex_params_ﬁle> IGNORE_UNEXPECTED_BARCODES=true TMP_

DIR=<temp_directory_location> &

III.1. Options for bcl-to-fastq conversion

for Illumina sequencing

Variables explained (which is also found in the Picard tool documentation):

n sequencing_run_dir: The sequencing raw data directory

n barcode_output_dir_name: Files with indexes of barcodes will be placed here. (Files will be named by

lane, and tile number with “_barcode.txt” at the end.)

n read_structure: A string explaining which cycle in the read corresponds to which part. T=template,

B=sample barcode, M=molecular barcode, S=skip (i.e., a 2x150 run with 8-bp sample barcode and 10-bp

molecular barcode would be: 150T8B10M150T). The cycle numbers for reads have to match those in the

RunInfo.xml ﬁle.

n barcode_ﬁle: File listing the barcodes expected (for a run with single sample barcode, columns are:

“library_name” “barcode_sequence_1” and “barcode_name.” File is tab-delimited and those names

have to be in the ﬁrst row. Library_name must be unique, as does the sample barcode).

n FCID, machine_name, and run_number are used to populate the read name info when using READ_

NAME_FORMAT=CASAVA_1_8

n multiplex_params: Similar to barcode ﬁle, but the columns are just “OUTPUT_PREFIX” and

“BARCODE_1.” I used the “library_name” from the other ﬁle as the “output_preﬁx,” for example.

File is also tab-delimited.

n temp_directory_location: Make sure that the tmp directory is large enough to hold a lot of ﬁles for

sorting. The default tmp dir on my server doesn’t have enough space, so I have to explicitly tell Picard

to use the other drive.

Picard tools ran in roughly the same amount of time as running with CASAVA. File sizes are correct. If

they want to mimic the default bcl2fastq ﬁltering, they should also set INCLUDE_NON_PF_READS=false

(defaults to true for Picard).

1. Ofﬂine bcl-to-fastq conversion for Illumina sequencing. See separate ﬁle.

2. Example sample sheet and other template csv ﬁles (Read length is shown

for demonstration purposes only.)

A. Example sample sheet, also available as template csv ﬁles upon request

QXT without adapter trimming

XT/XT2/RNA-seq/HaloPlex

HaloPlexHS

QXT with custom primer and

adapter-trimming options

III. Appendices

B. Library Prep Kit template csv ﬁles (containing index sequences and index layout) for

BaseSpace available upon request

As an alternative to the method described in section I, which is to use an existing Illumina Library Prep Kit

as a template and then edit the sample sheet to enter Agilent index and adapter sequences, you may

add the Agilent Library Prep Kit as a custom Library Prep Kit in IEM. This way, the custom Library

Prep Kit will be available in the IEM Library Prep Kit drop-down list, and the correct index and adapter

sequences (if adapter-trimming option is enabled) will be entered automatically in the sample sheet.

Follow these steps:

1, Generate custom Library Prep Kit txt ﬁle(s) and add the ﬁle(s) to

a. C:\Program Files (x86)\Illumina\Illumina Experiment Manager\SamplePrepKits

The below ﬁles are available for Agilent Library Prep Kits:

Haloplex_original_index_conﬁg.txt

HaloplexHS.txt

SureSelectXT-XT2-HaloPlex_revised_index_conﬁg.txt

SureSelectQXT.txt

2. Modify the application txt ﬁle(s) in

a. C:\Program Files (x86)\Illumina\Illumina Experiment Manager\Applications

b. to add the custom library prep kit(s) under “Compatible Sample Prep Kits.”

We recommend using the Agilent Library Prep Kit under the “FASTQ Only” application, so you

need to modify the following ﬁles for respective sequencers:

NextSeqGenerateFASTQ.txt (NextSeq)

HiSeqGenerateFASTQ.txt (HiSeq)

GenerateFASTQ.txt (MiSeq)

Example application txt ﬁles are available. The example application txt ﬁles have the previously

listed four Agilent Library Prep Kit types added. When adding the example txt ﬁle(s) into the

Applications folder, allow overwriting.

c. Re-launch IEM to enable the modiﬁcations.

3. How to add Agilent Library Prep Kits as custom Library Prep Kit types in IEM

(so sample sheet can be generated without having to be edited; also refer to the

“Creating Sample Prep Kit Type” section of the IEM user guide.)

III. Appendices

Platform Run Type Read Length SBS Kit Conﬁgration Chemistry

HiSeq 2500 Rapid 2x100/2x75 200 Cycle Kit v1/v2

HiSeq 2500 High Output 2x100/2x75 4 x 50 Cycle Kits or

200+50 Cycle Kits v3

HiSeq 2500 High Output 2x100/2x75 250 Cycle Kit v4

HiSeq 2000 All Runs 2x100/2x75 200 Cycle Kit v3

MiSeq All Runs 2x100 300 Cycle Kit v2

MiSeq All Runs 2x75 150 Cycle Kit v3

NextSeq 500/550 All Runs 2x75 150 Cycle Kit v1/v2

NextSeq 500/550 All Runs 2x100 300 Cycle Kit v1/v2

4. Illumina Kit Conﬁguration Selection Guide (The ones that have been validated

internally are highlighted.)

XT/XT2/RNA-Seq

III. Appendices

Platform Run Type Read Length SBS Kit Conﬁgration Chemistry

HiSeq 2500 Rapid 2x100/2x75 200 Cycle Kit v1/v2

HiSeq 2500 High Output 2x75 200 Cycle Kit v3

HiSeq 2500 High Output 2x100 4 x 50 Cycle Kits or

200+50 Cycle Kits v3

HiSeq 2500 High Output 2x100/2x75 250 Cycle Kit v4

HiSeq 2000 All Runs 2x75 200 Cycle kit v3

HiSeq 2000 All Runs 2x100 200+50 Cycle Kit v3

MiSeq All Runs 2x100 300 Cycle Kit v2

MiSeq All Runs 2x75 150 Cycle Kit v3

NextSeq 500/550 All Runs 2x100/2x75 300 Cycle Kit v1/v2

QXT

III. Appendices

Platform Run Type Read Length SBS Kit Conﬁgration Chemistry

HiSeq 2500 Rapid 2x100 200 Cycle Kit v1/v2

HiSeq 2500 Rapid 2x250 500 Cycle Kit v2

HiSeq 2500 High Output 2x100 200 Cycle Kit v3

HiSeq 2500 High Output 2x100 250 Cycle Kit v4

HiSeq 2000 All Runs 2x100 200 Cycle kit v3

MiSeq All Runs 2x100/2x150 300 Cycle Kit v2

MiSeq All Runs 2x250 500 Cycle Kit v2

MiSeq All Runs 2x250 600 Cycle Kit v3

NextSeq 500/550 All Runs 2x100 300 Cycle Kit v1/v2

HaloPlex

III. Appendices

Platform Run Type Read Length SBS Kit Conﬁgration Chemistry

HiSeq 2500 Rapid 2x100 200 Cycle Kit v1/v2

HiSeq 2500 Rapid 2x250 500 Cycle Kit v2

HiSeq 2500 High Output 2x100 4 x 50 Cycle Kits or

200+50 Cycle Kits v3

HiSeq 2500 High Output 2x100 250 Cycle Kit v4

HiSeq 2000 All Runs 2x100 4 x 50 Cycle Kit v3

MiSeq All Runs 2x100/2x150 300 Cycle Kit v2

MiSeq All Runs 2x250 500 Cycle Kit v2

MiSeq All Runs 2x250 600 Cycle Kit v3

NextSeq 500/550 All Runs 2x100 300 Cycle Kit v1/v2

HaloPlexHS

III. Appendices

5. Recommended seeding concentrations based on internal experience

Internally, we aim for 800 K/mm2 to 900 K/mm2 with the MiSeq and the HiSeq.

MiSeq: With the V2 sequencing kits, our range is mainly in the 9-pM to 13-pM range with

XT/XT2/HaloPlex/HaloPlexHS

. Note that Methyl-Seq has not been sequenced on the MiSeq.

We have not been using the V3 chemistry routinely, but the same range is applied. It is

expected that the V3 chemistry can support higher cluster density, so you may be able to

use higher seeding concentration.

HiSeq 2000: XT/XT2/HaloPlex/HaloPlexHS

, 6 pM to 8 pM. Methyl-Seq, 15 pM.

NextSeq 500: QXT/XT/XT2/HaloPlex, 1.2 pM to 1.4 pM with the V1 chemistry, and 1.8 pM

with the V2 chemistry. Target cluster density, 180 K/mm2 to 200 K/mm2

Note:

1) The concentrations above are based on quantitation by TapeStation, with the exception

of QXT whole-genome that would need to be run on a BioA because of the broader

library size range;

2) The clustering outcome can vary from instrument to instrument, and libraries are not all

equal even when concentration appears to be the same. We believe that these seeding

concentrations should achieve a good amount of high-quality data, but please be aware

that further optimization may be needed based on your own experience.

HiSeq 2500 Rapid: XT/XT2/HaloPlex, 8 pM to 12 pM. QXT with target enrichment, 13 pM;

for whole-genome, 20 pM. This is likely because of the broader size distribution of the QXT

whole-genome library. For strand-speciﬁc total RNA-Seq, we use 10 pM to 12 pM. (R&D has been

using the Rapid Mode only, but this should be comparable with the high-output mode).

6. How to modify an Agilent BED ﬁle into a manifest ﬁle

a. Open an Illumina manifest ﬁle in Excel for use as a template. For example: https://

support.illumina.com/content/dam/illumina-support/documents/downloads/

productﬁles/truseq/truseq-exome-targeted-regions-manifest-v1-2-bed.zip.

b. Clear the contents of columns 1 to 4 in the template ﬁle.

d. If the template ﬁle has more rows than the BED ﬁle, be sure to delete the extra rows.

e. Now you have an empty column 1 in the manifest ﬁle. Use the CONCATENATE function

to concatenate columns 2 and 3 (chr, start, and end) and create a name for each row in

column 1. This way you can make sure that each row has a unique name.

c. Open the BED ﬁle in Excel. Copy columns 1 to 3 and paste into columns 2 to 4 in the

above template.

f. Save this ﬁle as a tab delimited txt ﬁle under:

n C:\Users\useraccount\AppData\Roaming\Illumina\Illumina Experiment Manager\Manifests

n This should automatically make the manifest ﬁle available from IEM in the drop-down menu.

III. Appendices

7. Considerations for PhiX spike-in

9. Seeding concentration for ION sequencing and ION Sphere QC

8. ION system and reagent kits that have been used for template preparation and

sequencing of Agilent SureSelectXT PTN and HaloPlex/HaloPlexHS ION libraries

10. How to modify an Agilent BED ﬁle for uploading to the Ion Server

It is recommended to always include a standard 1% to 5% PhiX spike-in. This applies to all

Agilent NGS libraries, including the Methyl-Seq library.

For targeted sequencing with low complexity (e.g., <2000 amplicons), it might be helpful to

use a high-concentration spike-in of up to 25%.

Follow the dilution protocol and ION Sphere QC kit recommended for “gDNA Fragment or

Amplicon Library” in the ION template-preparation kit user manuals.

SureSelectXT PTN: Ion PI Template OT2 200 Kit v2 with the Ion OneTouch 2 system, and Ion

PI Template 200 kit v2.

HaloPlex/HaloPlexHS: Ion PGM Template OT2 400 kit with the Ion OneTouch 2 system, and

Ion PGM Sequencing 400 kit..

Note: We have not tested the Hi-Q and Hi-Q view kits, but those also should be compatible.

a. Open the BED ﬁle in Excel.

b. Remove the ﬁrst two lines, which are the browser position and the track name.

c. Remove the fourth column, which contains the annotations.

NGS Sequencer Guide

Navigation menu

Versions of this User Manual:

Views

Navigation