Adapters Pooling Guide (1000000041074) Illumina 1000000041074 02 20180523
User Manual:
Open the PDF directly: View PDF .
Page Count: 26
Download | |
Open PDF In Browser | View PDF |
Index Adapters Pooling Guide Introduction Pooling Guidelines Four-Channel Sequencing Two-Channel Sequencing One-Channel Sequencing TruSeq Pooling Guidelines Nextera Pooling Guidelines AmpliSeq for Illumina Pooling Guidelines Next Steps Technical Assistance Revision History Document # 1000000041074 v02 May 2018 For Research Use Only. Not for use in diagnostic procedures. 3 3 3 4 4 4 12 19 23 24 25 ILLUMINA PROPRIETARY Index Adapters Pooling Guide This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for the contractual use of its customer in connection with the use of the product(s) described herein and for no other purpose. This document and its contents shall not be used or distributed for any other purpose and/or otherwise communicated, disclosed, or reproduced in any way whatsoever without the prior written consent of Illumina. Illumina does not convey any license under its patent, trademark, copyright, or common-law rights nor similar rights of any third parties by this document. The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order to ensure the proper and safe use of the product(s) described herein. All of the contents of this document must be fully read and understood prior to using such product(s). FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND DAMAGE TO OTHER PROPERTY, AND WILL VOID ANY WARRANTY APPLICABLE TO THE PRODUCT(S). ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S) DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE). © 2018 Illumina, Inc. All rights reserved. All trademarks are the property of Illumina, Inc. or their respective owners. For specific trademark information, see www.illumina.com/company/legal.html. AmpliSeq is a registered trademark of Thermo Fisher Scientific. Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 2 Index Adapters Pooling Guide Introduction This document provides Illumina ® pooling guidelines for performing library prep for sequencing on Illumina sequencing systems. Visit the support page for your library prep kit on the Illumina website at www.illumina.com. Additional Resources This document supplements the library prep kit and workflow reference guides. Review the appropriate reference guide for protocol instructions and product details. The following documentation is available for download from the Illumina website. Resource Description Custom Protocol Selector support.illumina.com/custom-protocol-selector.html A wizard for generating customized end-to-end documentation that is tailored to the library prep method, run parameters, and analysis method used for the sequencing run. Illumina Adapter Sequences (document # 1000000002694) Provides the nucleotide sequences that comprise Illumina oligonucleotides used in Illumina sequencing technologies. Illumina Experiment Manager (document # 15031335) Provides information about creating and editing appropriate sample sheets for Illumina sequencing systems and analysis software and record parameters for your sample plate. Nextera DNA Flex Library Prep Pooling Guide (document # 1000000031471) Provides pooling guidelines for performing the Nextera™ DNA Flex library prep for sequencing on Illumina sequencing systems. Pooling Guidelines Selecting the correct index combinations avoids Index Read failure due to cluster registration failure and improves accuracy during data analysis. Illumina sequencing uses a two-channel or four-channel method to detect individual bases. It is important to maintain color balance for each base of the Index Read being sequenced, otherwise Index Read sequencing could fail due to registration failure. This base calling process also ensures accuracy for data analysis. Follow these low-plex pooling guidelines, depending on your index adapter component. Not all color-balanced pools are listed. Check the color balance using Illumina Experiment Manager (IEM) for the HiSeq worklfow. For more information, see the Illumina Experiment Manager Guide (document # 15031335). Four-Channel Sequencing Always use at least two unique and compatible barcodes for each index sequenced. Four-channel sequencing systems capture four distinct images, which allows cycle-by-cycle observation of which dye is incorporated into a cluster. A green laser is used to sequence G and T bases while a red laser sequences A and C bases. To ensure proper image registration, each cycle reads at least one of two nucleotides per color channel. Therefore, all four images are required to build the sequence. The MiSeq system and all HiSeq systems currently use four-channel chemistry. Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 3 Index Adapters Pooling Guide Two-Channel Sequencing u Index Reads must begin with at least one base other than G in either of the first two cycles. If an Index Read begins with two base calls of G, signal intensity is not generated and registration fails. Signal must be present in either of the first two cycles to ensure demultiplexing performance. u Select index sequences that provide signal in at least one channel, preferably both channels, for every cycle. u Red channel—A or C u Green channel—A or T Two-channel sequencing simplifies nucleotide detection because only two images are needed to determine all four base calls. Instead of using a separate dye for each base, two-channel sequencing uses a mix of dyes. Clusters with intensity in the red channel are C bases, and clusters with intensity in the green channel are T base. Clusters with intensity in both red and green are A base. Unlabeled clusters are G base. The NovaSeq, NextSeq, and MiniSeq platforms use two-channel chemistry. For more information on pooling for two-channel systems, see the Library pooling guidelines for the NextSeq and MiniSeq systems bulletin on the Illumina support site. One-Channel Sequencing The first two cycles of an index read cannot start with two G bases, otherwise intensity is not generated. To ensure demultiplexing performance, intensity must be present in either of the first two cycles. Make sure that at least one index sequence in a library pool does not start with two G bases. Select balanced index sequences so that signal is present in at least one image (preferably both images) for every cycle. The iSeq 100 System uses one-dye sequencing, which requires one dye and two images to encode data for the four bases. Intensities extracted from one image and compared to a second image result in four distinct populations, each corresponding to a nucleotide. Base calling determines which population each cluster belongs to. TruSeq Pooling Guidelines This section details pooling strategies for index adapter tubes and index adapter plates for TruSeq based index adapters (indexed by ligation). Index Adapter Tubes When using the Index Adapter Tubes, use the following pooling guidelines for single-indexed sequencing. TruSeq DNA Single Indexes–Sets A and B TruSeq DNA Single Index–Sets A and B each contain 12 unique indexes. When using these indexes, use the following pooling guidelines for single-indexed sequencing. The following tables detail pooling strategies for two to four samples generated with the index adapters in each set. For 5–11-plex pools, use the four-plex options with any other available adapters. Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 4 Index Adapters Pooling Guide Table 1 Single-Index Pooling Strategies for Two-Four Samples (DNA) Plexity Option Set A Only Set B Only 2 1 AD006 and AD012 Not recommended 2 AD005 and AD019 1 AD002, AD007, and AD019 AD001, AD010, and AD020 2 AD005, AD006, and AD015 AD003, AD009, and AD025 3 Two-plex options with any other available adapter AD008, AD011, and AD022 1 AD005, AD006, AD012, and AD019 AD001, AD008, AD010, and AD011 2 AD002, AD004, AD007, and AD016 AD003, AD009, AD022, and AD027 3 Three-plex options with any other available adapter Three-plex options with any other available adapter 3 4 Table 2 Single-Index Pooling Strategies for Two-Four Samples (RNA) Plexity Option Set A Only Set B Only 2 1 AR006 and AR012 Not recommended 2 AR005 and AR019 1 AR002, AR007, and AR019 AR001, AR010, and AR020 2 AR005, AR006, and AR015 AR003, AR009, and AR025 3 Two-plex options with any other available adapter AR008, AR011, and AR022 1 AR005, AR006, AR012, and AR019 AR001, AR008, AR010, and AR011 2 AR002, AR004, AR007, and AR016 AR003, AR009, AR022, and AR027 3 Three-plex options with any other available adapter Three-plex options with any other available adapter 3 4 Index Adapter Plate When using the Index Adapter Plate, use the following pooling guidelines for dual-indexed or single-indexed sequencing. Dual-Indexed Sequencing Dual-indexed libraries help ensure quality data and reliable downstream analyses. IDT for Illumina-TruSeq Unique Dual (UD) Indexes The IDT for Illumina-TruSeq UD Indexes are compatible with all Illumina sequencing systems. Use dualindexing when pooling > 12 samples in one pool. IDT for Illumina-TruSeq UD Indexes are intended for dual indexed sequencing. When performing a single indexed sequencing run when using IDT for Illumina-TruSeq UD Indexes, the same pooling guidelines apply. The following figure provides example dual-index pooling strategies when using the IDT for Illumina-TruSeq UD Indexes. Pool libraries of any plexity > 2 down a column (2-plex, 3-plex, 4-plex, 5-plex, etc) as shown in Figure 1. Do not pool across a row. Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 5 Index Adapters Pooling Guide Figure 1 Example Pooling Strategies TruSeq DNA and RNA Combinatorial Dual Indexes The following figures illustrate pooling strategies for 2–16 samples generated with the TruSeq DNA Combinatorial Dual Indexes (96 indexes, 96 samples) or TruSeq RNA Combinatorial Indexes (96 indexes, 96 samples). u Color-balanced pools are shaded gray and have green wells. u Two-plex pools are diagonal, shaded, and have green wells. u Odd-numbered pools have dark gray wells. The gray wells are not used for sequencing pooled libraries, but can be used for sequencing single libraries. Dual-Indexed, Two-Plex Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 6 Index Adapters Pooling Guide Dual-Indexed, Three-Plex Dual-Indexed, Four-Plex Dual-Indexed, Five-Plex Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 7 Index Adapters Pooling Guide Dual-Indexed, Six-Plex Dual-Indexed, Seven-Plex Dual-Indexed, Eight-Plex (Option 1) Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 8 Index Adapters Pooling Guide Dual-Indexed, Eight-Plex (Option 2) Dual-Indexed, 12-Plex Dual-Indexed, 16-Plex Single-Indexed Sequencing Use single-indexing when pooling ≤ 12 samples in one pool. The following figures illustrate pooling strategies for 2–12 samples generated with the TruSeq DNA Combinatorial Dual Indexes (96 indexes, 96 samples) or TruSeq RNA Combinatorial Indexes (96 indexes, 96 samples). u Color-balanced pools are shaded gray and have green wells. Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 9 Index Adapters Pooling Guide u Five-plex pools have dark gray wells. The gray wells are not used for sequencing pooled libraries, but can be used for sequencing single libraries. u For 7–11-plex pools, combine any of the two to six-plex pools. Single-Indexed, Two-Plex Single-Indexed, Three-Plex Single-Indexed, Four-Plex Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 10 Index Adapters Pooling Guide Single-Indexed, Five-Plex Single-Indexed, Six-Plex Single-Indexed, 12-Plex Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 11 Index Adapters Pooling Guide Nextera Pooling Guidelines This section details pooling strategies for index adapter tubes and index adapter plates for Nextera based index adapters (indexed by ligation). Nextera DNA 96 CD Indexes (96 indexes, plated) Kit Contents Table 3 Index i7 Adapters Index Name Bases in Adapter Bases for Sample Sheet Type H701 TCGCCTTA TAAGGCGA i7 H702 CTAGTACG CGTACTAG i7 H703 TTCTGCCT AGGCAGAA i7 H705 AGGAGTCC GGACTCCT i7 H706 CATGCCTA TAGGCATG i7 H707 GTAGAGAG CTCTCTAC i7 H710 CAGCCTCG CGAGGCTG i7 H711 TGCCTCTT AAGAGGCA i7 H712 TCCTCTAC GTAGAGGA i7 H714 TCATGAGC GCTCATGA i7 H720 AGGCTCCG CGGAGCCT i7 H723 GAGCGCTA TAGCGCTC i7 Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 12 Index Adapters Pooling Guide Plate Layout Table 4 96 Plex, Dual Indexed Plate Layout 1 2 3 4 5 6 7 8 9 10 11 12 A H505H701 H506H702 H517H703 H505H705 H506H707 H517H723 H505H706 H506H712 H517H720 H505H710 H506H711 H517H714 B H517H702 H505H703 H506H701 H517H707 H505H723 H506H705 H517H712 H505H720 H506H706 H517H711 H505H714 H506H710 C H506H703 H517H701 H505H702 H506H723 H517H705 H505H707 H506H720 H517H706 H505H712 H506H714 H517H710 H505H711 D H503H705 H503H707 H503H723 H503H706 H503H712 H503H720 H503H710 H503H711 H503H714 H503H701 H503H702 H503H703 E H516H706 H516H712 H516H720 H516H710 H516H711 H516H714 H516H701 H516H702 H516H703 H516H705 H516H707 H516H723 F H522H710 H510H711 H513H714 H522H701 H510H702 H513H703 H522H705 H510H707 H513H723 H522H706 H510H712 H513H720 G H513H711 H522H714 H510H710 H513H702 H522H703 H510H701 H513H707 H522H723 H510H705 H513H712 H522H720 H510H706 H H510H714 H513H710 H522H711 H510H703 H513H701 H522H702 H510H723 H513H705 H522H707 H510H720 H513H706 H522H712 Low Plexity Guidelines NovaSeq The NovaSeq sequencer does not require color balanced indexes; any quantity (including 1-plex), or combination of indexes, is supported. NOTE As an exception, H705 cannot be used as the sole i7 index on a NovaSeq run. Other Sequencers All pools listed are color-balanced (2-dye and 4-dye) on any Illumina sequencer. NOTE For more information on setting up a run in the MiniSeq Local Run Manager (LRM) software, see Trim Adapters for Nextera DNA Flex Kits in MiniSeq LRM Quick Reference Card (document # 1000000040431) . Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 13 Index Adapters Pooling Guide u 3-plex—use the first 3, or last 3, wells in a column u In 3-plex usage, rows D and E are not used. Figure 2 3-plex plate layout example u 4-plex—use the first 4, or last 4, wells in a column Figure 3 4-plex plate layout example Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 14 Index Adapters Pooling Guide u 5-plex—use the first 5 or last 5 wells in a column Figure 4 5-plex plate layout example u 6-plex—use the first 6 or last 6 wells in a column, or 2 from one column, and 4 from an adjacent column Figure 5 6-plex plate layout example Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 15 Index Adapters Pooling Guide u 7-plex—use the first 7, or last 7, wells in a column Figure 6 7-plex plate layout example u 8-plex—use a full column Figure 7 8-plex plate layout example Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 16 Index Adapters Pooling Guide u 9-plex+—use any collection of indexes containing color balanced pools (for example, A1-H1 + A2, or A4D4 + A5-E5) Figure 8 Various valid 9-plex plate layout examples Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 17 Index Adapters Pooling Guide Nextera DNA 24 CD Indexes (24 indexes, tubed) Kit Contents Table 5 Index i7 Adapters Index Name Bases in Adapter Bases for Sample Sheet Type H705 CGTCTAAT ATTAGACG i7 H706 TCGACTAG CTAGTCGA i7 H707 CCTAGAGT ACTCTAGG i7 H710 GCGTAAGA TCTTACGC i7 H711 TTATGCGA TCGCATAA i7 H714 TCGCCTTA TAAGGCGA i7 Table 6 Index i5 Adapters Index Name Bases in Adapter Bases for Sample Sheet NovaSeq, MiSeq, HiSeq 2000/2500 Bases for Sample Sheet MiniSeq, NextSeq, HiSeq 3000/4000/X Type H503 TATCCTCT TATCCTCT AGAGGATA i5 H505 GTAAGGAG GTAAGGAG CTCCTTAC i5 H506 ACTGCATA ACTGCATA TATGCAGT i5 H517 GCGTAAGA GCGTAAGA TCTTACGC i5 Low Throughput Guidelines NovaSeq The NovaSeq sequencer does not require color balanced indexes; any quantity (including 1-plex), or combination of indexes, is supported. NOTE As an exception, H705 cannot be used as the sole i7 index on a NovaSeq run. The pooling guidelines for other Illumina instruments are applicable. Other Sequencers All pools listed below are color-balanced (2-dye and 4-dye) on any Illumina sequencer. u 2-plex is not supported u 3-plex u i5—use H505, H506, and H517 u i7—use either (H705, H706, H707) or (H710, H711, H714) u 4-plex u i5—use all i5s Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 18 Index Adapters Pooling Guide u u i7—use either 3-plex pool + any i7 Example: H503-H705, H505-H706, H506-H707, H517-H710 u 5-plex u i5—use the 4-plex pool + any i5 u i7—use either 3-plex pool + any two i7s u Example: H503-H705, H505-H706, H506-H707, H517-H710, H503-H711 u 6-plex u i5—use the 4-plex pool + any two i5s OR two 3-plex pools u i7—use all six of the i7s or two 3-plex pools u Example: H503-H705, H505-H706, H506-H707, H517-H710, H503-H711, H505-H714 u 7-plex u i5—use the 4-plex pool + any three i5s OR two 3-plex pools + any i5 u i7—use all six of the i7s + an additional i7 or two 3-plex pools + any i7 u 8-plex u i5—use all of the i5s (twice each) u i7—use all six of the i7s + any two additional i7s u 9-plex+ u Use as many valid pools in your set as possible; at a minimum, use at least one valid pool, plus remaining indexes. NOTE For more information on setting up a run in the MiniSeq Local Run Manager (LRM) software, see Trim Adapters for Nextera DNA Flex Kits in MiniSeq LRM Quick Reference Card (document # 1000000040431) . AmpliSeq for Illumina Pooling Guidelines This section details pooling strategies for index adapter plates for AmpliSeq for Illumina based index adapters. AmpliSeq for Illumina Combinatorial Dual (CD) Indexes AmpliSeq CD Indexes for Illumina are compatible with all Illumina sequencing systems. Indexes are intended for dual index sequencing. NOTE For pools that contain 8–96 samples, any index combination can be used. Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 19 Index Adapters Pooling Guide The following table shows the plate layout of AmpliSeq CD indexes for Illumina. Figure 9 Plate Layout for AmpliSeq CD indexes for Illumina Index 1 (i7) Adapters CAAGCAGAAGACGGCATACGAGA[i7]GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG Table 7 Index i7 Adapters Index Name Bases for Sample Sheet Q7005 GTGAATAT Q7006 ACAGGCGC Q7007 CATAGAGT Q7008 TGCGAGAC Q7015 TCTCTACT Q7016 CTCTCGTC Q7017 CCAAGTCT Q7018 TTGGACTC Q7023 GCAGAATT Q7024 ATGAGGCC Q7025 ACTAAGAT Q7026 GTCGGAGC Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 20 Index Adapters Pooling Guide Index 2 (i5) Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Table 8 Index i5 Adapters Index Name i5 Bases for Sample Sheet MiSeq i5 Bases for Sample Sheet MiniSeq, NextSeq Q5001 AGCGCTAG CTAGCGCT Q5002 GATATCGA TCGATATC Q5007 ACATAGCG CGCTATGT Q5008 GTGCGATA TATCGCAC Q5009 CCAACAGA TCTGTTGG Q5010 TTGGTGAG CTCACCAA Q5013 AACCGCGG CCGCGGTT Q5014 GGTTATAA TTATAACC Adapter Trimming The following sequence is needed for adapter trimming. CTGTCTCTTATACACATCT Low Plexity Guidelines To achieve unique dual indexing, pool between two and eight samples according to the following guidelines. NOTE These guidelines are for 1–8 samples, there are no specific pooling requirements for pooling more than eight samples (up to 96). For columns, the fundamental unit is two, however other combinations are supported. All combinations apply to any column on the plate. The example shown in Figure 10 provides dual indexing strategies for columns when using AmpliSeq for Illumina CD indexes. u Two in a column as shown in orange in the following combinations: u A-B u C-D u E-F u G-H u Three in a column, as shown in gray in the following combinations: u A-C u D-F or u u u C-E F-H Four in a column, as shown in purple in the following combinations: u A-D Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 21 Index Adapters Pooling Guide u u E-H Five in a column, as shown in blue in the following combinations: u A-E or u u D-H Six in a column, as shown in green in the following combinations: u A-F or u u C-H Seven in a column, as shown in pink in the following combinations: u A-G or u u B-H Eight in a column, as shown in teal. NOTE All eight combinations in any column are unique index combinations. Figure 10 Example of Column Pooling Guidelines for Low Plexity For rows, the fundamental unit is three, however any set of pools can be in a row as long as they are contained between columns 1-6 or columns 7-12. All combinations apply to any row on the plate. The example shown in Figure 11 provides dual indexing strategies for rows when using AmpliSeq for Illumina CD indexes. u Three in a row, as shown in gray in the following combinations: u 1-3 u 4-6 u 7-9 Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 22 Index Adapters Pooling Guide u u 10-12 Six in a row, as shown in green in the following combinations: u 1-6 u 7-12 Figure 11 Example of Row Pooling Guidelines for Low Plexity Next Steps When library prep is complete, you are ready to begin sequencing. For information on setting up an indexed sequencing run, see the system guide for your sequencing system. Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 23 Index Adapters Pooling Guide Technical Assistance For technical assistance, contact Illumina Technical Support. Website: Email: www.illumina.com techsupport@illumina.com Illumina Customer Support Telephone Numbers Region Toll Free Regional North America +1.800.809.4566 Australia +1.800.775.688 Austria +43 800006249 +43 19286540 Belgium +32 80077160 +32 34002973 China 400.066.5835 Denmark +45 80820183 +45 89871156 Finland +358 800918363 +358 974790110 France +33 805102193 +33 170770446 Germany +49 8001014940 +49 8938035677 Hong Kong 800960230 Ireland +353 1800936608 +353 016950506 Italy +39 800985513 +39 236003759 Japan 0800.111.5011 Netherlands +31 8000222493 New Zealand 0800.451.650 Norway +47 800 16836 Singapore +1.800.579.2745 Spain +34 911899417 +34 800300143 Sweden +46 850619671 +46 200883979 Switzerland +41 565800000 +41 800200442 Taiwan 00806651752 United Kingdom +44 8000126019 Other countries +44.1799.534000 +31 207132960 +47 21939693 +44 2073057197 Safety data sheets (SDSs)—Available on the Illumina website at support.illumina.com/sds.html. Product documentation—Available for download in PDF from the Illumina website. Go to support.illumina.com, select a product, then select Documentation & Literature. Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 24 Index Adapters Pooling Guide Revision History Document Date Description of Change Document #1000000041074 v02 May 2018 Added One-channel Sequencing section for iSeq. Document #1000000041074 v01 January 2018 Added section for AmpliSeq for Illumina pooling guidelines. Incorporated Nextera DNA Flex pooling guidelines. Document #1000000041074 v00 October 2017 Initial release. Document # 1000000041074 v02 For Research Use Only. Not for use in diagnostic procedures. 25 Document # 1000000041074 v02 Illumina 5200 Illumina Way San Diego, California 92122 U.S.A. +1.800.809.ILMN (4566) +1.858.202.4566 (outside North America) techsupport@illumina.com www.illumina.com For Research Use Only. Not for use in diagnostic procedures. © 2018 Illumina, Inc. All rights reserved.
Source Exif Data:
File Type : PDF File Type Extension : pdf MIME Type : application/pdf PDF Version : 1.4 Linearized : No Page Count : 26 Page Mode : UseOutlines Language : en-us Producer : madbuild Create Date : 2018:04:16 14:37:08-07:00 Modify Date : 2018:04:16 14:37:08-07:00 Title : Index Adapters Pooling Guide (1000000041074) Author : Illumina Subject : Guidelines for preparing libraries for Illumina sequencing systems that require balanced index combinations.EXIF Metadata provided by EXIF.tools